Tutorial (Python) ================= Please download the files in https://github.com/rlrq/MINORg/tree/master/examples. In all the examples below, you should replace "/path/to" with the appropriate full path name, which is usually to the directory containing these example files. Setting up the tutorial ~~~~~~~~~~~~~~~~~~~~~~~ To ensure that the examples in this tutorial work, please replace '/path/to' in the files 'arabidopsis_genomes.txt', 'athaliana_genomes.txt', and 'subset_genome_mapping.txt' with the full path to the directory containing the example files. Getting started ~~~~~~~~~~~~~~~ To begin, import the :class:`~minorg.MINORg.MINORg` class. >>> from minorg.MINORg import MINORg To create a MINORg object: >>> my_minorg = MINORg(directory = "/path/to/output/directory", prefix = "prefix") Both ``directory`` and ``prefix`` are optional. If not provided, they will default to the current directory and 'minorg' respectively. If the directory does not currently exist, it will be created. If you wish to use the default values specified in a config file, use this instead: >>> my_minorg = MINORg(config = "/path/to/config.ini", directory = "/path/to/output/directory", prefix = "prefix") You may now set your parameters using the attributes of your :class:`~minorg.MINORg.MINORg` object. For a table listing the equivalent CLI arguments and :class:`~minorg.MINORg.MINORg` attributes, see :ref:`Parameters:CLI vs Python`. IMPT: Note on executables ~~~~~~~~~~~~~~~~~~~~~~~~~ See: :ref:`Parameters:Executables` You can specify executables as such: >>> my_minorg.blastn = '/path/to/blastn/executable' >>> my_minorg.rpsblast = '/path/to/rpsblast/executable' >>> my_minorg.mafft = '/path/to/mafft/executable' >>> my_minorg.bedtools = '/path/to/bedtools2/bin' Note that BEDTools is unique in that if it is not in your command-search path, you should provide the path **TO THE DIRECTORY CONTAINING ITS EXECUTABLES** (i.e. there will not be a single 'bedtools' executable), and if it **IS** in your command-search path you **SHOULD NOT** be using the :attr:`~minorg.MINOR.MINORg.bedtools` attribute. See :ref:`Parameters:Executables` for more on executables. Defining target sequences ~~~~~~~~~~~~~~~~~~~~~~~~~ User-provided targets +++++++++++++++++++++ Let us begin with the simplest MINORg execution: >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_200_target") >>> my_minorg.target = "/path/to/sample_CDS.fasta" >>> my_minorg.full() >>> my_minorg.resolve() The above combination of arguments tells MINORg to generate gRNA from targets in a user-provided FASTA file (``my_minorg.target = 'pat/to/sample_CDS.fasta'``) and to output files into the directory ``/path/to/output/directory/example_200_target``. By default, MINORg generates 20 bp gRNA using NGG PAM. The full MINORg programme is executed by calling the :meth:`~minorg.MINORg.MINORg.full` method (``my_minorg.full()``). Don't forget to call :meth:`~minorg.MINORg.MINORg.resolve` to remove any temporary files. Reference gene(s) as targets ++++++++++++++++++++++++++++ >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_201_refgene") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G45050", "AT5G45060", "AT5G45200", "AT5G45210", "AT5G45220", "AT5G45230", "AT5G45240", "AT5G45250"] >>> my_minorg.query_reference = True >>> my_minorg.full() >>> my_minorg.resolve() In the above example, ``my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10")`` is used to specify information about a reference genome: * Positional argument 1: path to reference assembly (In this case ``"/path/to/subset_ref_TAIR10.fasta"``) * Positional argument 2: path to reference annotation (In this case ``"/path/to/subset_ref_TAIR10.gff"``) * Optional keyword argument 1 (``alias``): genome alias (in this case ``"TAIR10"``); a unique name for the reference genome, used when referring to it in sequence names and output files. Autogenerated by MINORg if not provided. * See :meth:`~minorg.MINORg.MINORg.add_reference` and :ref:`Tutorial_py:Non-standard reference` for how to specify genetic code and non-standard attribute field names ``my_minorg.genes = ["AT5G45050", "AT5G45060", "AT5G45200", "AT5G45210", "AT5G45220", "AT5G45230", "AT5G45240", "AT5G45250"]`` tells MINORg the target gene(s), and ``my_minorg.query_reference = True`` tells MINORg to generate gRNA for reference gene(s). Non-reference gene(s) as targets ++++++++++++++++++++++++++++++++ Extending the reference ^^^^^^^^^^^^^^^^^^^^^^^ See also: :ref:`Parameters:Extended genome` If you have both genomic and CDS-only sequences of your target genes but not a GFF3 annotation file, MINORg can infer coding regions (CDS) for your target genes using :meth:`~minorg.MINORg.MINORg.extend_reference`. See :ref:`Parameters:Extended genome` for how to name your sequences to ensure proper mapping of CDS to genes. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_202_ext") >>> my_minorg.extend_reference("/path/to/sample_gene.fasta", "/path/to/sample_CDS.fasta") >>> my_minorg.genes = ["AT1G10920"] >>> my_minorg.query_reference = True >>> my_minorg.full() >>> my_minorg.resolve() :meth:`~minorg.MINORg.MINORg.extend_reference` effectively adds new genes to the reference genome, so they can be used just like any reference gene. Therefore, they can also be used in combination with :meth:`~minorg.MINORg.MINORg.add_query`. Inferring homologues in unannotated genomes ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ See also: :ref:`Algorithms:Non-reference homologue inference` If you would like MINORg to infer homologues in non-reference genomes, you can use :meth:`~minorg.MINORg.MINORg.add_query` to specify the FASTA files of those non-reference genomes. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_203_query") >>> my_minorg.extend_reference("/path/to/sample_gene.fasta", "/path/to/sample_CDS.fasta") >>> my_minorg.genes = ["AT1G10920"] >>> my_minorg.add_query("/path/to/subset_9654.fasta", alias = "9654") >>> my_minorg.add_query("/path/to/subset_9655.fasta", alias = "9655") >>> my_minorg.full() >>> my_minorg.resolve() In the above example, ``my_minorg.add_query("/path/to/subset_9654.fasta", alias = "9654")`` and ``my_minorg.add_query("/path/to/subset_9655.fasta", alias = "9655")`` are used to specify information about query FASTA files. * The alias keyword argument is optional. If not provided, MINORg will generate a unique alias. * Query FASTA files are stored as a dictionary with the format {:} at :attr:`~minorg.MINORg.MINORg.query`. * If you'd like to remove a query file that you've added, you can use: >>> my_minorg.remove_query("9654") * The :meth:`~minorg.MINORg.MINORg.remove_query` method takes a query alias. If you did not specify an alias when using :meth:`~minorg.MINORg.MINORg.add_query` and do not know the alias of the file you wish to remove, you may view the query-FASTA mapping using the :attr:`~minorg.MINORg.MINORg.query` attribute. >>> my_minorg.query {"9654": "/path/to/subset_9654.fasta", "9655": "/path/to/subset_9655.fasta"} Domain as targets +++++++++++++++++ MINORg allows users to specify the identifier of an RPS-BLAST position-specific scoring matrix (PSSM-Id) to further restrict the target sequence to a given domain associated with the PSSM-Id. This could be particularly useful when designing gRNA for genes that do not share conserved domain structures but do share a domain that you wish to knock out. Local database ^^^^^^^^^^^^^^ >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_204_domain") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G45050"] >>> my_minorg.query_reference = True >>> my_minorg.rpsblast = "/path/to/rpsblast/executable" >>> my_minorg.db = "/path/to/rpsblast/db" >>> my_minorg.pssm_ids = ["214815"] >>> my_minorg.full() >>> my_minorg.resolve() In the above example, gRNA will be generated for the WRKY domain (PSSM-Id 214815 as of CDD database v3.18) of the gene AT5G45050. Users are responsible for providing the PSSM-Id of a domain that exists in the gene. If multiple PSSM-Ids are provided, overlapping domains will be combined and output WILL NOT distinguish between one PSSM-Id or another. Unlike other examples, the database (:attr:`~minorg.MINORg.MINORg.db`) is not provided as part of the example files. If you are using the full Docker image pulled from rlrq/minorg, the database is bundled with the image. Otherwise, you will have to download it yourself. See :ref:`Parameters:RPS-BLAST local database` for more information. Remote database ^^^^^^^^^^^^^^^ While it is in theory possible to use the remote CDD database & servers instead of local ones, the ``--remote`` option for the 'rpsblast'/'rpsblast+' command from the BLAST+ package has never worked for me. In any case, if your version of local rpsblast is able to access the remote database, you can use :attr:`~minorg.MINORg.MINORg.remote_rps`. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_204_domain") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G45050"] >>> my_minorg.query_reference = True >>> my_minorg.rpsblast = "/path/to/rpsblast/executable" >>> my_minorg.db = "Cdd" >>> my_minorg.remote_rps = True >>> my_minorg.pssm_ids = ["214815"] >>> my_minorg.full() >>> my_minorg.resolve() Defining gRNA ~~~~~~~~~~~~~ See also: :ref:`Parameters:PAM` By default, MINORg generates 20 bp gRNA using SpCas9's NGG PAM. You may specify other gRNA length using :attr:`~minorg.MINORg.MINORg.length` and other PAM using :attr:`~minorg.MINORg.MINORg.pam`. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_205_grna") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G45050"] >>> my_minorg.query_reference = True >>> my_minorg.length = 23 >>> from minorg import pam >>> my_minorg.pam = pam.Cas12a >>> my_minorg.full() >>> my_minorg.resolve() In the example above, MINORg will generate 19 bp gRNA (``my_minorg.length = 23``) using Cas12a's unusual 5' PAM pattern (TTTV) (``my_minorg.pam = pam.Cas12a``). MINORg has several built-in PAMs (see :ref:`Parameters:Preset PAM patterns` for options), and also supports customisable PAM patterns using ambiguous bases and regular expressions (see :ref:`Parameters:PAM` for format). To use preset PAMs, such as in the example above, you will first need to import MINORg's :ref:`minorg.pam:minorg.pam module` (``from minorg import pam``), then use ``pam.`` (such as ``pam.Cas12a``) to refer to the desired PAM pattern. Filtering gRNA ~~~~~~~~~~~~~~ MINORg supports 3 different gRNA filtering options, all of which can be used together. Filter by GC content ++++++++++++++++++++ >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_206_gc") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G45050"] >>> my_minorg.query_reference = True >>> my_minorg.gc_min = 0.2 >>> my_minorg.gc_max = 0.8 >>> my_minorg.full() >>> my_minorg.resolve() In the above example, MINORg will exclude gRNA with less than 20% (``my_minorg.gc_min = 0.2``) or greater than 80% (``my_minorg.gc_min = 0.8``) GC content. By default, minimum GC content is 30% and maximum is 70%. Filter by off-target ++++++++++++++++++++ See: :ref:`Algorithms:Off-target assessment` Using total mismatch/gap/unaligned ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ See: :ref:`Algorithms:Total mismatch/gap/unaligned` Thresholds for total number of mismatches or gaps (and unaligned positions) required for an off-target gRNA hit to be considered non-problematic are controlled by :attr:`~minorg.MINORg.MINORg.ot_mismatch` and :attr:`~minorg.MINORg.MINORg.ot_gap` respectively. See :ref:`Algorithms:Total mismatch/gap/unaligned` for more. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_207_ot_ref") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G45050"] >>> my_minorg.query_reference = True >>> my_minorg.screen_reference = True >>> my_minorg.add_background("/path/to/subset_ref_Araly2.fasta", alias = "araly") >>> my_minorg.add_background("/path/to/subset_ref_Araha1.fasta", alias = "araha") >>> my_minorg.add_background("/path/to/subset_9654.fasta", alias = "9654") >>> my_minorg.add_background("/path/to/subset_9655.fasta", alias = "9655") >>> my_minorg.ot_gap = 2 >>> my_minorg.ot_mismatch = 2 >>> my_minorg.full() >>> my_minorg.resolve() In the above example, MINORg will screen gRNA for off-targets in: * The reference genome (``my_minorg.screen_reference``) * Four different FASTA files (``my_minorg.add_background("", alias = "")``) * The alias keyword argument is optional. If not provided, MINORg will generate a unique alias. * Note that any AT5G45050 homologues in these four FASTA files will NOT be masked. This means that only gRNA that do not target any AT5G45050 homologues in these four genomes will pass this off-target check. * To mask homologues in these genomes, you will need to provide a FASTA file containing the sequences of their homologues using ``my_minorg.mask = ["/path/to/to_mask_1.fasta", "/path/to/to_mask_2.fasta"]``. You may use subcommand :meth:`~minorg.MINORg.MINORg.seq` (see :ref:`Tutorial_py:Subcommands`) to identify these homologues and retrieve their sequences. :attr:`~minorg.MINORg.MINORg.ot_gap` and :attr:`~minorg.MINORg.MINORg.ot_mismatch` control the minimum number of gaps or mismatches off-target gRNA hits must have to be considered non-problematic; any gRNA with at least one problematic gRNA hit will be excluded. By default, both values are set to '1'. See :ref:`Algorithms:Off-target assessment` for more on the off-target assessment algorithm. In the case above, ``my_minorg.screen_reference = True`` is actually redundant as the genome(s) from which targets are obtained (which, because of ``my_minorg.query_reference``, is the reference genome) are automatically included for background check. However, in the example below, when the targets are from **non-reference genomes**, the reference genome is not automatically included for off-target assessment and thus :attr:`~minorg.MINORg.MINORg.screen_reference` is NOT redundant. Additionally, do note that the genes specified using :attr:`~minorg.MINORg.MINORg.gene` are masked in the reference genome, such that any gRNA hits to them are NOT considered off-target and will NOT be excluded. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_208_ot_nonref") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G45050"] >>> my_minorg.add_query("/path/to/subset_9654.fasta", alias = "9654") >>> my_minorg.screen_reference = True >>> my_minorg.add_background("/path/to/subset_ref_Araly2.fasta", alias = "araly") >>> my_minorg.add_background("/path/to/subset_ref_Araha1.fasta", alias = "araha") >>> my_minorg.add_background("/path/to/subset_9655.fasta", alias = "9655") >>> my_minorg.ot_gap = 2 >>> my_minorg.ot_mismatch = 2 >>> my_minorg.full() >>> my_minorg.resolve() Using position-specific mismatch/gap/unaligned ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ See: :ref:`Algorithms:Position-specific mismatch/gap/unaligned` Finer control of off-target definition can be achieved using :attr:`~minorg.MINORg.MINORg.ot_pattern`, which allows users to provide a pattern that specifies different thresholds for different positions along a gRNA. Unlike :attr:`~minorg.MINORg.MINORg.ot_mismatch` and :attr:`~minorg.MINORg.MINORg.ot_gap`, which specify the **LOWER-bound of NON-problematic** hits, :attr:`~minorg.MINORg.MINORg.ot_pattern` specifies **UPPER-bound of PROBLEMATIC** hits. By default, unaligned positions will be treated as mismatches, but this behaviour can be altered by setting :attr:`~minorg.MINORg.MINORg.ot_unaligned_as_mismatch` to ``False``. See :ref:`Parameters:Off-target pattern` for how to build an off-target pattern, and :ref:`Algorithms:Position-specific mismatch/gap/unaligned` for more on how unaligned positions can be counted. When :attr:`~minorg.MINORg.MINORg.ot_pattern` is specified, :attr:`~minorg.MINORg.MINORg.ot_mismatch` and :attr:`~minorg.MINORg.MINORg.ot_gap` will be ignored. The following example is identical to the first in :ref:`Tutorial_py:Using total mismatch/gap/unaligned`, except ``ot_mismatch`` and ``ot_gap`` are replaced with ``ot_pattern``. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_209_ot_ref_pattern") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G45050"] >>> my_minorg.query_reference = True >>> my_minorg.screen_reference = True >>> my_minorg.add_background("/path/to/subset_ref_Araly2.fasta", alias = "araly") >>> my_minorg.add_background("/path/to/subset_ref_Araha1.fasta", alias = "araha") >>> my_minorg.add_background("/path/to/subset_9654.fasta", alias = "9654") >>> my_minorg.add_background("/path/to/subset_9655.fasta", alias = "9655") >>> my_minorg.ot_pattern = "0mg-10,1mg-11-" >>> my_minorg.full() >>> my_minorg.resolve() In the above example, ``my_minorg.ot_pattern = "0mg-10,1mg-11-"`` means that MINORg will discard any gRNA with at least one off-target hit where: * There are no mismatches or gaps between positions -10 and -1, and there are no more than 1 mismatch or gap from position -11 to the 5' end. See :ref:`Parameters:Off-target pattern` for how to build and interpret an off-target pattern. PAM-less off-target check ^^^^^^^^^^^^^^^^^^^^^^^^^ By default, MINORg does NOT check for the presence of PAM sites next to potential off-target hits. You may override this behaviour by setting :attr:`~minorg.MINORg.MINORg.ot_pamless` to ``False``. This tells MINORg to mark off-target hits that fail the :attr:`~minorg.MINORg.MINORg.ot_gap` or :attr:`~minorg.MINORg.MINORg.ot_mismatch` thresholds (or match :attr:`~minorg.MINORg.MINORg.ot_pattern`) as problematic ONLY IF there is a PAM site nearby. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_210_ot_pamless") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G45050"] >>> my_minorg.add_query("/path/to/subset_9654.fasta", alias = "9654") >>> my_minorg.screen_reference = True >>> my_minorg.add_background("/path/to/subset_ref_Araly2.fasta", alias = "araly") >>> my_minorg.add_background("/path/to/subset_ref_Araha1.fasta", alias = "araha") >>> my_minorg.add_background("/path/to/subset_9655.fasta", alias = "9655") >>> my_minorg.ot_gap = 2 >>> my_minorg.ot_mismatch = 2 >>> my_minorg.ot_pamless = True >>> my_minorg.full() >>> my_minorg.valid_grna("background") ## gRNA that pass background filtering gRNAHits(gRNA = 6) >>> my_minorg.ot_pamless = False ## only remove gRNA from candidates if off-target hits have PAM site nearby >>> my_minorg.full() >>> my_minorg.valid_grna("background") gRNAHits(gRNA = 12) >>> my_minorg.resolve() Skip off-target check ^^^^^^^^^^^^^^^^^^^^^ To skip off-target check entirely, use ``background_check = False`` when calling :meth:`~minorg.MINORg.MINORg.full`. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_211_skipbgcheck") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G45050"] >>> my_minorg.query_reference = True >>> my_minorg.full(background_check = False) (several warning messages about the background check being unset will pop up, but you can ignore them) >>> my_minorg.resolve() Filter by feature +++++++++++++++++ See: :ref:`Algorithms:Within-feature inference` By default, when :attr:`~minorg.MINORg.MINORg.genes` is set, MINORg restricts gRNA to coding regions (CDS). For more on how MINORg does this for inferred, unannotated homologues, see :ref:`Algorithms:Within-feature inference`. You may change the feature type in which to design gRNA using the attribute :attr:`~minorg.MINORg.MINORg.feature`. See column 3 of your GFF3 file for valid feature types (see https://en.wikipedia.org/wiki/General_feature_format for more on GFF file format). >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_212_withinfeature") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G45050"] >>> my_minorg.query_reference = True >>> my_minorg.feature = "three_prime_UTR" >>> my_minorg.full(background_check = False) >>> my_minorg.resolve() Generating minimum gRNA set(s) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Number of sets ++++++++++++++ By default, MINORg outputs a single gRNA set covering all targets. You may request more (mutually exclusive) sets using the :attr:`~minorg.MINORg.MINORg.set` attribute. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_213_set") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G46260", "AT5G46270", "AT5G46450", "AT5G46470", "AT5G46490", "AT5G46510", "AT5G46520"] >>> my_minorg.query_reference = True >>> my_minorg.sets = 5 >>> my_minorg.full() >>> my_minorg.resolve() Prioritise non-redundancy +++++++++++++++++++++++++ By default, MINORg selects gRNA for sets using these criteria in decreasing order of priority: #. Coverage (of as yet uncovered targets) #. Proximity to 5' end #. Non-redundancy Proximity is only assessed when there is a tie for coverage, and non-redundancy when there is a tie for both coverage and proximity. You may instead prioritise non-redundancy over proximity by setting :attr:`~minorg.MINORg.MINORg.prioritise_nr` to ``True``. MINORg will use a combination of approximate and optimal weighted set cover algorithms to output small sets with low redundancy. However, do note that the sets will in general be larger than when :attr:`~minorg.MINORg.MINORg.prioritise_nr` is ``False``. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_214_nr") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G46260", "AT5G46270", "AT5G46450", "AT5G46470", "AT5G46490", "AT5G46510", "AT5G46520"] >>> my_minorg.query_reference = True >>> my_minorg.prioritise_nr = True >>> my_minorg.full() >>> my_minorg.resolve() Excluding gRNA ++++++++++++++ You may specify gRNA sequences to exclude from any final gRNA set by providing the path to a FASTA file containing sequences to exclude to :attr:`~minorg.MINORg.MINORg.exclude`. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_215_exclude") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G46260", "AT5G46270", "AT5G46450", "AT5G46470", "AT5G46490", "AT5G46510", "AT5G46520"] >>> my_minorg.query_reference = True >>> my_minorg.exclude = "/path/to/sample_exclude_RPS6.fasta" >>> my_minorg.full() >>> my_minorg.resolve() The gRNA names in the file passed to :attr:`~minorg.MINORg.MINORg.exclude` do not matter. Only the sequences are used when determining whether to exclude a gRNA. Accepting unknown checks ++++++++++++++++++++++++ Sometimes, not all filtering checks (GC, background, and feature) are set for all sequences. This is not an issue if you use the full programme (i.e. :meth:`~minorg.MINORg.MINORg.full`), but may be relevant if you are re-generating sets using the 'minimumset' subcommand (i.e. :meth:`~minorg.MINORg.MINORg.minimumset`) with a modified mapping file OR a mapping file from the 'filter' subcommand where not all filters have been applied. Let us take a look at 'sample_custom_check.map', where we've added a custom check called 'my_custom_check' in the last column:: gRNA id gRNA sequence target id target sense gRNA strand start end group background GC feature my_custom_check gRNA_001 CTTCATCTTCTTCTCGAAAT targetA NA + 8 27 1 pass pass NA pass gRNA_001 CTTCATCTTCTTCTCGAAAT targetB NA + 80 99 1 pass pass NA pass gRNA_002 GATGTTTTCTTGAGCTTCAG targetA NA + 37 56 1 pass pass NA NA gRNA_002 GATGTTTTCTTGAGCTTCAG targetB NA + 286 305 1 pass pass NA pass gRNA_002 GATGTTTTCTTGAGCTTCAG targetC NA + 109 128 1 pass pass NA fail gRNA_002 GATGTTTTCTTGAGCTTCAG targetD NA + 110 129 1 pass pass NA fail gRNA_003 ATGTTTTCTTGAGCTTCAGA targetB NA + 38 57 1 pass pass NA NA gRNA_003 ATGTTTTCTTGAGCTTCAGA targetC NA + 287 306 1 pass pass NA pass gRNA_003 ATGTTTTCTTGAGCTTCAGA targetD NA + 110 129 1 pass pass NA pass There are three possible values for check status: 'pass', 'fail', and 'NA'. An invalid/unset check is an 'NA'. If a check is unset for all entries (as is the case with the check 'feature' here), it will be ignored (i.e. the check is treated as 'pass' for all entries). However, when a check has been set for some entries but not others (as is the case with the 'my_custom_check' check here), MINORg will treat invalid/unset checks as 'fail' by default. This is because there isn't enough information on whether this constitutes a pass or fail for the check, and MINORg prefers to be conservative when outputting gRNA. You may override this behaviour by setting :attr:`~minorg.MINORg.MINORg.accept_invalid` to ``True``. By doing so, MINORg will treat 'NA' as 'pass' for all checks. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_216_acceptinvalid") >>> my_minorg.parse_grna_map_from_file("/path/to/sample_custom_check.map") >>> my_minorg.accept_invalid = True >>> my_minorg.minimumset() Manually approve gRNA sets ++++++++++++++++++++++++++ You may opt to manually inspect each gRNA set before MINORg write them to file by using ``manual = True`` when executing :meth:`~minorg.MINORg.MINORg.full` or the minimum set subcommand :meth:`~minorg.MINORg.MINORg.minimumset`. .. code-block:: python >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_217_manual") >>> my_minorg.target = "/path/to/sample_CDS.fasta" >>> my_minorg.full(manual = True) ID sequence (Set 1) gRNA_001 GGAATACAAGAGATTATCGA Hit 'x' to continue if you are satisfied with these sequences. Otherwise, enter the sequence ID or sequence of an undesirable gRNA (case-sensitive) and hit the return key to update this list: x Final gRNA sequence(s) have been written to minorg_gRNA_final.fasta Final gRNA sequence ID(s), gRNA sequence(s), and target(s) have been written to minorg_gRNA_final.map 1 mutually exclusive gRNA set(s) requested. 1 set(s) found. Output files have been generated in /path/to/example_217_manual Subcommands ~~~~~~~~~~~ MINORg comprises of four main steps: #. Target sequence identification #. Candidate gRNA generation #. gRNA filtering #. Minimum gRNA set generation As users may only wish to execute a subset of these steps instead of the full programme (:meth:`~minorg.MINORg.MINORg.full`), MINORg also provides four subcommands (methods) corresponding to these four steps: #. :meth:`~minorg.MINORg.MINORg.seq` #. :meth:`~minorg.MINORg.MINORg.grna` #. :meth:`~minorg.MINORg.MINORg.filter`, which itself calls three other methods * :meth:`~minorg.MINORg.MINORg.filter_background` * :meth:`~minorg.MINORg.MINORg.filter_feature` * :meth:`~minorg.MINORg.MINORg.filter_gc` #. :meth:`~minorg.MINORg.MINORg.minimumset` The subcommands may be useful if you already have a preferred off-target/on-target assessment software. In this case, you may execute subcommands :meth:`~minorg.MINORg.MINORg.seq` and :meth:`~minorg.MINORg.MINORg.grna`, submit the gRNA output by MINORg for off-target/on-target assessment, update the .map file output by MINORg with the status of each gRNA for that off-target/on-target assessment, and execute :meth:`~minorg.MINORg.MINORg.minimumset` to obtain a desired number of minimum gRNA sets. Note that if you do this, you should re-read the updated .map file into MINORg using :meth:`~minorg.MINORg.MINORg.parse_grna_map_from_file` so MINORg can replace the gRNA data stored in memory with your updated gRNA data. Each subcommand may require a different combination of attributes. Subcommand :meth:`~minorg.MINORg.MINORg.seq` ++++++++++++++++++++++++++++++++++++++++++++ The :meth:`~minorg.MINORg.MINORg.seq` subcommand identifies target sequences, whether by extracting them from a reference genome or inferring homologues in unannotated genomes. All parameters introduced in :ref:`Tutorial_py:Defining target sequences` (except attribute :attr:`~minorg.MINORg.MINORg.target`) and :ref:`Tutorial_py:Defining reference genomes` apply. If you already have a FASTA file containing your target sequences, you may set :attr:`~minorg.MINORg.MINORg.target` to the path of that FASTA file and skip this subcommand. This step will output target sequences into a file ending with '_targets.fasta'. This filename will be stored at attribute :attr:`~minorg.MINORg.MINORg.target`. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_218_subcmdseq") >>> my_minorg.extend_reference("/path/to/sample_gene.fasta", "/path/to/sample_CDS.fasta") >>> my_minorg.genes = ["AT1G10920"] >>> my_minorg.add_query("/path/to/subset_9654.fasta", alias = "9654") >>> my_minorg.add_query("/path/to/subset_9655.fasta", alias = "9655") >>> my_minorg.seq() >>> my_minorg.target '/path/to/example_218_subcmdseq/minorg/minorg_gene_targets.fasta' Subcommand :meth:`~minorg.MINORg.MINORg.grna` +++++++++++++++++++++++++++++++++++++++++++++ The :meth:`~minorg.MINORg.MINORg.grna` subcommand generates gRNA within target sequences from a target file. Unlike the command line version, it **DOES NOT** incorporate parts of the :meth:`~minorg.MINORg.MINORg.seq` and :meth:`~minorg.MINORg.MINORg.filter` subcommands. All parameters introduced in :ref:`Tutorial_py:Defining gRNA` apply. By default, .map and FASTA files of gRNA sequences will be written to files. You may override this behaviour by setting :attr:`~minorg.MINORg.MINORg.auto_update_files` to ``False`` or using ``auto_update_files = False`` when instantiating a :class:`~minorg.MINORg.MINORg` object (e.g. ``my_minorg(directory = "/path/to/output/dir", auto_update_files = False)``). In this case, only the FASTA file will be written. To manually write files, you should use the following methods. If you do not supply an output file path, it will be automatically generated: * :meth:`~minorg.MINORg.MINORg.write_all_grna_map`: write .map file containing all candidate gRNA (no checks will be set by :meth:`~minorg.MINORg.MINORg.grna` so all entries in check fields will be 'NA') * Path to output file will be stored at :attr:`~minorg.MINORg.MINORg.grna_map` * If output file is not specified, the output file will be //_gRNA_all.map * :meth:`~minorg.MINORg.MINORg.write_all_grna_fasta`: write FASTA file containing all candidate gRNA * Path to output file will be stored at :attr:`~minorg.MINORg.MINORg.grna_fasta` * If output file is not specified, the output file will be //_gRNA_all.fasta >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_219_subcmdgrna") >>> my_minorg.target = "/path/to/sample_CDS.fasta" >>> my_minorg.grna() ## default 3' NGG PAM PAM pattern: .{20}(?=[GATC]GG) >>> my_minorg.grna_hits gRNAHits(gRNA = 201) >>> from minorg import pam >>> my_minorg.pam = pam.Cas12a ## 5' TTTV PAM >>> my_minorg.grna() ## regenerate gRNA PAM pattern: (?<=TTT[ACG]).{20} >>> my_minorg.grna_hits gRNAHits(gRNA = 95) >>> my_minorg.pam = "ATV." >>> my_minorg.grna() ## regenerate gRNA PAM pattern: (?<=AT[ACG]).{20} >>> my_minorg.grna_hits gRNAHits(gRNA = 267) >>> my_minorg.write_all_grna_fasta() >>> my_minorg.grna_fasta '/path/to/example_218_subcmdgrna/minorg/minorg_gRNA_all.fasta' >>> my_minorg.write_all_grna_fasta("/path/to/another/location.fasta") >>> my_minorg.grna_fasta '/path/to/another/location.fasta' gRNA data is stored at the attribute :attr:`~minorg.MINORg.MINORg.grna_hits`, and it prints the number of gRNA as a string representation. In the above example, 201 different gRNA are generated from the target sequences in the target file "sample_CDS.fasta". We then decided we want to generate gRNA for Cas12a instead, which has a 5' TTTV PAM pattern. This yields us 95 different gRNA. Finally we decided to try a completely made up 5' ATV PAM pattern, netting us 267 different gRNA in the end. Satisfied, we wrote the sequences of these gRNA to file, and printed the path of the file. Subcommand :meth:`~minorg.MINORg.MINORg.filter` +++++++++++++++++++++++++++++++++++++++++++++++ The :meth:`~minorg.MINORg.MINORg.filter` subcommand takes in a compulsory MINORg .map file (which can be read using :meth:`~minorg.MINORg.MINORg.parse_grna_map_from_file`) and rewrites some/all checks. You can execute all filters (GC, off-target, and feature) using :meth:`~minorg.MINORg.MINORg.filter`, or execute checks separately using :meth:`~minorg.MINORg.MINORg.filter_gc`, :meth:`~minorg.MINORg.MINORg.filter_background`, and :meth:`~minorg.MINORg.MINORg.filter_feature`. By default, gRNA sequences and map files will be updated automatically whenever any of the filtering methods is called. You may override this behaviour by setting :attr:`~minorg.MINORg.MINORg.auto_update_files` to ``False`` or using ``auto_update_files = False`` when instantiating a :class:`~minorg.MINORg.MINORg` object (e.g. ``my_minorg(directory = "/path/to/output/dir", auto_update_files = False)``). To manually write files, you should use the following methods. If you do not supply an output file path, it will be automatically generated: * :meth:`~minorg.MINORg.MINORg.write_all_grna_map`: write .map file containing all candidate gRNA and checks * Path to output file will be stored at :attr:`~minorg.MINORg.MINORg.grna_map` * If output file is not specified, the output file will be //_gRNA_all.map * :meth:`~minorg.MINORg.MINORg.write_all_grna_fasta`: write FASTA file containing all candidate gRNA * Path to output file will be stored at :attr:`~minorg.MINORg.MINORg.grna_fasta` * If output file is not specified, the output file will be //_gRNA_all.fasta * This file will NOT be auto updated as it is not affected by filtering check status * :meth:`~minorg.MINORg.MINORg.write_pass_grna_map`: write .map file containing all passing gRNA * Path to output file will be stored at :attr:`~minorg.MINORg.MINORg.pass_map` * If output file is not specified, the output file will be //_gRNA_pass.map * :meth:`~minorg.MINORg.MINORg.write_pass_grna_fasta`: write FASTA file containing all passing gRNA * Path to output file will be stored at :attr:`~minorg.MINORg.MINORg.pass_fasta` * If output file is not specified, the output file will be //_gRNA_pass.fasta In all cases, you may rename the gRNA using :meth:`~minorg.MINORg.MINORg.rename_grna`, which takes in the path of a FASTA file that contains the gRNA sequences you wish to rename with sequence IDs of the names you wish to rename them to. This method should be used before you call any of the above methods to write gRNA to file. Subcommand :meth:`~minorg.MINORg.MINORg.filter_gc` ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ All parameters introduced in :ref:`Tutorial_py:Filter by GC content` apply. Filtering by GC content after calling :meth:`~minorg.MINORg.MINORg.full` ************************************************************************ :meth:`~minorg.MINORg.MINORg.filter_gc` can be used on an active MINORg object even if you've already called :meth:`~minorg.MINORg.MINORg.full`. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_220_subcmdfilter_gc") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G45050", "AT5G45060", "AT5G45200", "AT5G45210", "AT5G45220", "AT5G45230", "AT5G45240", "AT5G45250"] >>> my_minorg.query_reference = True >>> my_minorg.full() >>> my_minorg.grna_hits gRNAHits(gRNA = 2141) >>> my_minorg.valid_grna("GC") ## gRNA that pass GC filter gRNAHits(gRNA = 1871) >>> my_minorg.gc_min = 0.2 >>> my_minorg.gc_max = 0.8 >>> my_minorg.filter_gc() ## re-filter by GC content >>> my_minorg.valid_grna("GC") ## gRNA that pass GC filter gRNAHits(gRNA = 2097) >>> my_minorg.minimumset() >>> my_minorg.resolve() Filtering GC content on output of another MINORg run **************************************************** >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_220_subcmdfilter_gc_pt2", auto_update_files = False) >>> my_minorg.parse_grna_map_from_file("/path/to/sample_custom_check.map") >>> my_minorg.valid_grna("GC") gRNAHits(gRNA = 3) >>> my_minorg.gc_min = 0.4 >>> my_minorg.gc_max = 0.6 >>> my_minorg.filter_gc() >>> my_minorg.valid_grna("GC") gRNAHits(gRNA = 1) >>> my_minorg.write_pass_grna_fasta() >>> my_minorg.resolve() Subcommand :meth:`~minorg.MINORg.MINORg.filter_background` ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ All parameters introduced in :ref:`Tutorial_py:Filter by off-target` apply. Additionally, you should supply target sequences to :attr:`~minorg.MINORg.MINORg.target` so that MINORg can mask them (this tells MINORg that any gRNA hits to them is in fact on-target and NOT off-target). Any additional sequences to be masked may be provided to :attr:`~minorg.MINORg.MINORg.mask` as a list of paths to FASTA files. If you have set :attr:`~minorg.MINORg.MINORg.screen_reference` to ``True`` to include reference genome(s) (see :ref:`Tutorial_py:Multiple reference genomes` for how to specify multiple reference genomes) in the off-target screen, you may specify a FASTA file of sequences of genes to be masked to :attr:`~minorg.MINORg.MINORg.mask` as well. You can generate these sequences using the :meth:`~minorg.MINORg.MINORg.seq` subcommand, but **MAKE SURE TO USE A DIFFERENT MINORg OBJECT AND DIRECTORY TO AVOID OVERWRITING ANY PREVIOUSLY GENERATED FILES**. Filtering background after calling :meth:`~minorg.MINORg.MINORg.full` ********************************************************************* Let us first execute MINORg. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_221_subcmdfilter_bg") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G46450", "AT5G46470", "AT5G46490", "AT5G46510", "AT5G46520"] >>> my_minorg.add_query("/path/to/subset_9654.fasta", alias = "9654") >>> my_minorg.add_query("/path/to/subset_9655.fasta", alias = "9655") >>> my_minorg.sets = 5 >>> my_minorg.full(background_check = False) In the code above, we skipped off-target check using ``background_check = False`` when executing :meth:`~minorg.MINORg.MINORg.full`. But we've changed out mind and would like to screen the reference genome and the non-reference genomes that these targets are from AND we don't want our gRNA to be able to target any genes in 'subset_9944.fasta' and 'subset_9947'. We also want to tell MINORg that it's okay if a gRNA has off-target effects in homologous genes AT5G46260 and AT5G46270 in the reference genome. We can do that using the :meth:`~minorg.MINORg.MINORg.filter` subcommand, followed by the :meth:`~minorg.MINORg.MINORg.minimumset` subcommand to regenerate minimum sets. In order to do all this, we will have to get the gene sequences of AT5G46260 and AT5G46270 in order to mask them in the reference genome. We can do this using the :meth:`~minorg.MINORg.MINORg.get_reference_seq` method. >>> ot_minorg = MINORg(directory = "/path/to/example_221_subcmdfilter_bg_tomask") ## different directory >>> ot_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> ot_minorg.genes = ["AT5G46260", "AT5G46270"] >>> fout_to_mask = ot_minorg.mkfname("ref_to_mask.fasta") ## MINORg has a built-in method to generate file names within the output directory >>> ot_minorg.get_reference_seq(fout = fout_to_mask) ## this method will return a dictionary of sequences, but will also write to file if 'fout' is used >>> ot_minorg.resolve() Now that we have the reference sequences to mask, we can pass the file name to ``my_minorg``\ 's :attr:`~minorg.MINORg.MINORg.mask` attribute, add our background files using :meth:`~minorg.MINORg.MINORg.add_background`, set :attr:`~minorg.MINORg.MINORg.screen_reference` to ``True``, call :meth:`~minorg.MINORg.MINORg.filter_background` to update off-target checks for all candidate gRNA, and execute :meth:`~minorg.MINORg.MINORg.minimumset` to regenerate our minimum gRNA sets. You may also wish to call :meth:`~minorg.MINORg.MINORg.write_all_grna_map`, :meth:`~minorg.MINORg.MINORg.write_pass_grna_map`, and/or :meth:`~minorg.MINORg.MINORg.write_pass_grna_fasta` to update the gRNA FASTA and .map files if :attr:`~minorg.MINORg.MINORg.auto_update_files` has been set to ``False``. >>> my_minorg.mask.append(fout_to_mask) >>> my_minorg.add_background("/path/to/subset_9944.fasta", alias = "9944") >>> my_minorg.add_background("/path/to/subset_9947.fasta", alias = "9947") >>> my_minorg.screen_reference = True >>> my_minorg.filter_background() >>> my_minorg.minimumset() >>> my_minorg.resolve() Filtering background on output of another MINORg run **************************************************** Alternatively, if the orginal ``my_minorg`` object no longer exists, whether because you've closed the IDE session or deleted the object, you can read its .map file into a new :class:`~minorg.MINORg.MINORg` object using :meth:`~minorg.MINORg.MINORg.parse_grna_map_from_file` like below. In this case, you can pass the IDs of the additional genes to be masked together with the original genes to :attr:`~minorg.MINORg.MINORg.genes` and don't need to use :meth:`~minorg.MINORg.MINORg.get_reference_seq`. Since we're no longer querying 'subset_9654.fasta' and 'subset_9655.fasta', we can use :meth:`~minorg.MINORg.MINORg.add_background` to tell MINORg to search for off-target effects in them. And don't forget to also provide the FASTA file of target sequences to :attr:`~minorg.MINORg.MINORg.target` so MINORg can mask them!: >>> from minorg.MINORg import MINORg >>> new_minorg = MINORg(directory = "/path/to/example_221_subcmdfilter_bg_new") >>> new_minorg.parse_grna_map_from_file("/path/to/example_221_subcmdfilter_bg/minorg/minorg_gRNA_all.map") >>> new_minorg.target = "/path/to/example_221_subcmdfilter_bg/minorg/minorg_gene_targets.fasta" >>> new_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> new_minorg.genes = ["AT5G46260", "AT5G46270", "AT5G46450", "AT5G46470", "AT5G46490", "AT5G46510", "AT5G46520"] >>> new_minorg.add_background("/path/to/subset_9654.fasta", alias = "9654") >>> new_minorg.add_background("/path/to/subset_9655.fasta", alias = "9655") >>> new_minorg.add_background("/path/to/subset_9944.fasta", alias = "9944") >>> new_minorg.add_background("/path/to/subset_9947.fasta", alias = "9947") >>> new_minorg.screen_reference = True >>> new_minorg.filter_background() >>> new_minorg.minimumset() >>> new_minorg.resolve() Subcommand :meth:`~minorg.MINORg.MINORg.filter_feature` ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ All parameters introduced in :ref:`Tutorial_py:Filter by feature` apply. Additionally, you will need to provide a FASTA file of target sequences (attribute :attr:`~minorg.MINORg.MINORg.target`), reference genome(s) (see :ref:`Tutorial_py:Defining reference genomes`), and genes (attribute :attr:`~minorg.MINORg.MINORg.genes`). The specified reference gene(s) will be extracted from the reference genome(s) and aligned with target sequence(s) in order for MINORg to infer feature boundaries in target sequence(s). See :ref:`Algorithms:Within-feature inference` for the algorithm of how feature boundaries are inferred. Filtering feature after calling :meth:`~minorg.MINORg.MINORg.full` ****************************************************************** Let us first execute MINORg. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_222_subcmdfilter_feature") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.genes = ["AT5G45050"] >>> my_minorg.add_query("/path/to/subset_9654.fasta", alias = "9654") >>> my_minorg.add_query("/path/to/subset_9655.fasta", alias = "9655") >>> my_minorg.full() >>> my_minorg.valid_grna("feature") ## gRNA that pass within-feature filter gRNAHits(gRNA = 368) By default, MINORg sets the desired feature to 'CDS'. You can re-assess and overwrite the 'feature' check in the .map file to only allow gRNA in other GFF features, such as the 3' UTR, by updating :attr:`~minorg.MINORg.MINORg.feature` and using :meth:`~minorg.MINORg.MINORg.filter_feature` to re-filter gRNA for the new feature. >>> my_minorg.feature = "three_prime_UTR" >>> my_minorg.filter_feature() >>> my_minorg.valid_grna("feature") ## gRNA that pass within-feature filter gRNAHits(gRNA = 5) >>> my_minorg.minimumset() >>> my_minorg.resolve() Filtering feature on output of another MINORg run ************************************************* As with :ref:`Tutorial_py:Filtering background on output of another MINORg run`, we can read in the output of a previous MINORg execution and filter that. This requires the .map file ending with '_all.map' (parse using :meth:`~minorg.MINORg.MINORg.parse_grna_map_from_file`) as well as a FASTA file of target sequences (specify using :attr:`~minorg.MINORg.MINORg.target`). >>> from minorg.MINORg import MINORg >>> new_minorg = MINORg(directory = "/path/to/example_222_subcmdfilter_feature_new") >>> new_minorg.parse_grna_map_from_file("/path/to/example_222_subcmdfilter_feature/minorg/minorg_gRNA_all.map") >>> new_minorg.target = "/path/to/example_222_subcmdfilter_feature/minorg/minorg_gene_targets.fasta" >>> new_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> new_minorg.genes = ["AT5G45050"] ## MINORg needs to know which reference genes to align to targets to in order to infer feature ranges >>> new_minorg.feature = "three_prime_UTR" >>> new_minorg.filter_feature() >>> new_minorg.minimumset() >>> new_minorg.resolve() Subcommand :meth:`~minorg.MINORg.MINORg.minimumset` +++++++++++++++++++++++++++++++++++++++++++++++++++ The :meth:`~minorg.MINORg.MINORg.minimumset` subcommand generates mutually exclusive minimum set(s) of gRNA, where each set is capable of covering all targets. It requires a MINORg .map file (the one that ends in '_gRNA_pass.map' is sufficient, but '_gRNA_all.map' would allow for filtering by a custom combination of fields). All parameters introduced in :ref:`Tutorial_py:Generating minimum gRNA set(s)` apply. This step will write final gRNA sequences into a file ending with '_gRNA_final.fasta'. A file ending with '_gRNA_final.map' that maps gRNA to their targets will also be generated. You may optionally specify the location of the FASTA and .map output files using: * :attr:`~minorg.MINORg.MINORg.final_map`: path of .map file containing gRNA in final set(s) * If output file is not specified, the output file will be //_gRNA_final.map * :attr:`~minorg.MINORg.MINORg.final_fasta`: path of FASTA file containing gRNA in final set(s) * If output file is not specified, the output file will be //_gRNA_final.fasta Regenerating minimum sets after calling :meth:`~minorg.MINORg.MINORg.full` ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ :meth:`~minorg.MINORg.MINORg.minimumset` can also be used on an active MINORg object. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_223_subcmdminimumset_pt1") ... ... >>> my_minorg.full() >>> my_minorg.sets = 5 >>> my_minorg.minimumset() ## regenerate up to 5 gRNA sets Generating minimum sets from output of another MINORg run ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_223_subcmdminimumset_pt2") >>> my_minorg.parse_grna_map_from_file("/path/to/example_203_query/minorg/minorg_gRNA_all.map") >>> my_minorg.target = "/path/to/example_203_query/minorg/minorg_gene_targets.fasta" >>> my_minorg.prioritise_nr = True >>> my_minorg.sets = 5 >>> my_minorg.minimumset(gc_check = False) >>> my_minorg.resolve() In order for MINORg to better assess a gRNA's proximity to the 5' end (of hopefully sense strand) of a target in the event a tie-breaker is necessary, it is strongly suggested that target sequences be provided to :attr:`~minorg.MINORg.MINORg.target` so MINORg knows how long a target sequence is. This is especially so if the target sequences are antisense ones (you can check this using the .map file) generated by MINORg's inferences of homologues in unannotated genomes. In the example above, we've asked MINORg to ignore the GC content check when generating minimum sets (``my_minorg.minimumset(gc_check = False)``). Chaining subcommands ++++++++++++++++++++ You may use subcommands separately if you'd like to inspect the outcome of each step and/or repeat a step with different parameters before proceeding with the next. MINORg tracks the output of previous steps, so you do not need to read them into MINORg before executing the next step. .. code-block:: python >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_224_subcmd", prefix = "test", thread = 1) >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10", replace = True) >>> my_minorg.add_reference("/path/to/subset_ref_Araly2.fasta", "/path/to/subset_ref_Araly2.gff", alias = "araly2") >>> my_minorg.genes = ["AT1G33560", "AL1G47950.v2.1"] >>> my_minorg.query_reference = True >>> my_minorg.seq() ## generate target sequences >>> my_minorg.target ## print path to FASTA file containing target sequences '/path/to/example_223_subcmd/minorg/minorg_gene_targets.fasta' >>> my_minorg.grna() PAM pattern: .{20}(?=[GATC]GG) >>> my_minorg.screen_reference = True >>> my_minorg.filter_background() Masking on-targets Finding off-targets >>> my_minorg.valid_grna("background") gRNAHits(gRNA = 395) >>> my_minorg.add_background("/path/to/subset_ref_Araha1.fasta", alias = "araha1") ## add background file >>> my_minorg.filter_background() ## repeat background check with additional background file Masking on-targets Finding off-targets >>> my_minorg.valid_grna("background") ## updated set of passing gRNA gRNAHits(gRNA = 250) >>> my_minorg.filter_gc() >>> my_minorg.valid_grna("GC") gRNAHits(gRNA = 355) >>> my_minorg.valid_grna("background", "GC") gRNAHits(gRNA = 223) >>> my_minorg.valid_grna() ## gRNA filtered for all valid checks (at this point, background and GC) /path/to/minorg/grna.py:823: MINORgWarning: The following hit checks have not been set: feature gRNAHits(gRNA = 223) >>> my_minorg.filter_feature() ## by default, MINORg only retains gRNA in CDS >>> my_minorg.valid_grna("feature") gRNAHits(gRNA = 324) >>> my_minorg.valid_grna() gRNAHits(gRNA = 181) >>> my_minorg.minimumset(manual = True) ID sequence (Set 1) gRNA_026 GTCGTTTCCGGAGACTATGA Hit 'x' to continue if you are satisfied with these sequences. Otherwise, enter the sequence ID or sequence of an undesirable gRNA (case-sensitive) and hit the return key to update this list: gRNA_026 ID sequence (Set 1) gRNA_223 TCAATCTCCATCATAGTCTC Hit 'x' to continue if you are satisfied with these sequences. Otherwise, enter the sequence ID or sequence of an undesirable gRNA (case-sensitive) and hit the return key to update this list: x Final gRNA sequence(s) have been written to /path/to/example_223_subcmd/minorg/minorg_gRNA_final.fasta Final gRNA sequence ID(s), gRNA sequence(s), and target(s) have been written to /path/to/example_223_subcmd/minorg/minorg_gRNA_final.map 1 mutually exclusive gRNA set(s) requested. 1 set(s) found. >>> my_minorg.write_all_grna_map() ## write .map file containing check information for all candidate gRNA >>> my_minorg.write_all_grna_fasta() ## write FASTA file containing all candidate gRNA >>> my_minorg.write_pass_grna_map() ## write .map file containing information for valid gRNA >>> my_minorg.write_pass_grna_fasta() ## write FASTA file containing valid gRNA >>> my_minorg.resolve() ## remove temporary files It is highly recommended that you execute :meth:`~minorg.MINORg.MINORg.resolve` to remove any temporary files generated. Defining reference genomes ~~~~~~~~~~~~~~~~~~~~~~~~~~ Single reference genome +++++++++++++++++++++++ See example in :ref:`Tutorial_py:Reference gene(s) as targets`. Multiple reference genomes ++++++++++++++++++++++++++ See also: :ref:`Parameters:Reference` You may specify genes from multiple reference genomes so long as those reference genomes have also been added using :meth:`~minorg.MINORg.MINORg.add_reference`. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_225_multiref") >>> my_minorg.add_reference("/path/to/subset_ref_TAIR10.fasta", "/path/to/subset_ref_TAIR10.gff", alias = "TAIR10") >>> my_minorg.add_reference("/path/to/subset_ref_Araly2.fasta", "/path/to/subset_ref_Araly2.gff", alias = "Araly2") >>> my_minorg.add_reference("/path/to/subset_ref_Araha1.fasta", "/path/to/subset_ref_Araha1.gff", alias = "Araha1") >>> my_minorg.genes = ["AT1G33560", "AL1G47950.v2.1", "Araha.3012s0003.v1.1"] >>> my_minorg.query_reference = True >>> my_minorg.full() >>> my_minorg.resolve() In the example above, MINORg will design gRNA for 3 highly conserved paralogues in 3 different species. Note that you should be careful that any gene IDs you use should either be unique across all reference genomes OR be shared only among your target genes. Otherwise, MINORg will treat any undesired genes with the same gene IDs as targets as well. Non-standard reference ++++++++++++++++++++++ Non-standard genetic code ^^^^^^^^^^^^^^^^^^^^^^^^^ When using :attr:`~minorg.MINORg.MINORg.pssm_ids`, users should ensure that the correct genetic code has been specified for reference genomes using the ``genetic_code`` keyword argument when adding reference genomes using :meth:`~minorg.MINORg.MINORg.add_reference`, as MINORg has to first translate CDS into peptides for domain search using RPS-BLAST. The default genetic code is the Standard Code. Please refer to https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi for genetic code numbers and names. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_226_geneticcode") >>> my_minorg.add_reference("/path/to/subset_ref_yeast_mt.fasta", "/path/to/subset_ref_yeast_mt.gff", alias = "yeast_mt", genetic_code = 3) ## specify genetic code here >>> my_minorg.genes = ["gene-Q0275"] >>> my_minorg.query_reference = True >>> my_minorg.rpsblast = "/path/to/rpsblast/executable" >>> my_minorg.db = "/path/to/rpsblast/db" >>> my_minorg.pssm_ids = ["366140"] >>> my_minorg.full() >>> my_minorg.resolve() In the above example, the gene 'gene-Q0275' is a yeast mitochondrial gene, and ``my_minorg.pssm_ids = ["366140"]`` specifies the PSSM-Id for the COX3 domain in the Cdd v3.18 RPS-BLAST database. The genetic code number for yeast mitochondrial code is '3'. As a failsafe, MINORg does not terminate translated peptide sequences at the first stop codon. This ensures that any codons after an incorrectly translated premature stop codon will still be translated. Typically, a handful of mistranslated codons can still result in the correct RPS-BLAST domain hits, although hit scores may be slightly lower. Nevertheless, to ensure maximum accuracy, the correct genetic code is preferred. Non-standard GFF3 attribute field names ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ See also: :ref:`Parameters:Attribute modification` MINORg requires standard attribute field names in GFF3 files in order to properly map subfeatures to their parent features (e.g. map CDS to mRNA, and mRNA to gene). Non-standard field names should be mapped to standard ones using the ``attr_mod`` (for 'attribute modification') keyword argument when adding reference genomes using :meth:`~minorg.MINORg.MINORg.add_reference`. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_227_attrmod") >>> my_minorg.add_reference("/path/to/subset_ref_irgsp.fasta", "/path/to/subset_ref_irgsp.gff", alias = "irgsp", attr_mod = {"mRNA": {"Parent": "Locus_id"}}) ## specify attribute modifications >>> my_minorg.genes = ["Os01g0100100"] >>> my_minorg.query_reference = True >>> my_minorg.full() >>> my_minorg.resolve() The IRGSP 1.0 reference genome for rice (*Oryza sativa* subsp. Nipponbare) uses a non-standard attribute field name for mRNA entries in their GFF3 file. Instead of 'Parent', which is the standard name of the field used to map a feature to its parent feature, mRNA entries in the IRGSP 1.0 annotation use 'Locus_id'. See :ref:`Parameters:Attribute modification` for more details on how to format the input to ``attr_mod``. Multithreading ~~~~~~~~~~~~~~ MINORg supports multi-threading in order to process files in parallel. Any excess threads may also be used for BLAST. This is most useful when you are querying multiple genomes, have multiple reference genomes, or multiple background sequences. **NOTE for Docker users**: Multithreading for parallel querying of multiple genomes and backgrounds is DISABLED for Docker distributions due to incompatibilities. To run MINORg with parallel processing, set :attr:`~minorg.MINORg.MINORg.thread` to the desired number of threads. >>> from minorg.MINORg import MINORg >>> my_minorg = MINORg(directory = "/path/to/example_228_thread") >>> my_minorg.extend_reference("/path/to/sample_gene.fasta", "/path/to/sample_CDS.fasta") >>> my_minorg.genes = ["AT1G10920"] >>> my_minorg.add_query("/path/to/subset_9654.fasta", alias = "9654") >>> my_minorg.add_query("/path/to/subset_9655.fasta", alias = "9655") >>> my_minorg.thread = 2 >>> my_minorg.full() >>> my_minorg.resolve() Differences between CLI and Python versions ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Note that, unlike the command line, the Python package does not support aliases even if the config file has been set up appropriately for command line executions. Therefore, there are no true equivalents to ``--cluster``, ``--indv``, or ``--reference``. To specify cluster genes ++++++++++++++++++++++++ Analogous to ``--cluster`` and ``--gene``. **Correct:** >>> my_minorg.genes = ['AT5G46260','AT5G46270','AT5G46450','AT5G46470','AT5G46490','AT5G46510','AT5G46520'] **Incorrect:** >>> my_minorg.cluster_set = '/path/to/subset_cluster_mapping.txt' >>> my_minorg.cluster = 'RPS6' Attributes 'cluster_set' and 'cluster' do not exist. This does not throw error now but will cause problems later. To specify query FASTA files ++++++++++++++++++++++++++++ Analogous to ``--indv`` and ``--query``. **Correct:** >>> my_minorg.add_query('/path/to/subset_9654.fasta', alias = '9654') >>> my_minorg.add_query('/path/to/subset_9655.fasta', alias = '9655') **Incorrect:** >>> my_minorg.genome_set = '/path/to/subset_genome_mapping.txt' >>> my_minorg.indv = '9654,9655' Attributes 'genome_set' and 'indv' do not exist. This does not throw error now but will cause problems later. To specify reference genomes ++++++++++++++++++++++++++++ Analogous to ``--reference``, ``--assembly``, ``--annotation``, ``--attr-mod``, and ``--genetic-code``. **Correct:** >>> my_minorg.add_reference('/path/to/TAIR10.fasta', '/path/to/TARI10.gff3', alias = 'TAIR10', genetic_code = 1, atr_mod = {}) Note that ``attr_mod`` and ``genetic_code`` are optional if the annotation uses standard attribute field names and the standard genetic code, which the example above does. **Incorrect:** >>> my_minorg.reference_set = '/path/to/arabidopsis_genomes.txt' >>> my_minorg.reference = 'TAIR10' AttributeError: can't set attribute Attributes 'reference_set' does not exist, and 'reference' is a property that users are not allowed to directly modify.